Antibiotic Resistance Gene-Carrying Plasmid Spreads

Antibiotic Resistance Gene-Carrying Plasmid Spreads into the Plant Endophytic Micro organism utilizing Soil Micro organism as Carriers

Purposes of animal manure and handled wastewater might enrich antibiotic-resistant micro organism (ARB) and antibiotic resistance genes (ARGs) within the plant microbiome. Nevertheless, the mechanistic research of the transmission of ARB and ARGs from the atmosphere to plant endophytic micro organism had been few. Herein, a genetically engineered fluorescent Escherichia coli harboring a conjugative RP4 plasmid that carries three ARGs was used to hint its unfold into Arabidopsis thaliana inside in a tetracycline-amended hydroponic system within the absence or presence of a simulated soil bacterial group. Confocal microscope remark demonstrated that E. coli was internalized into plant tissues and the carried RP4 plasmid was transferred into plant endophytic micro organism.

Extra importantly, we noticed that soil micro organism inhibited the internalization of E. coli however considerably promoted RP4 plasmid unfold into the plant microbiome. The altered RP4-carrying bacterial group composition within the plant microbiome and the elevated core-shared RP4-carrying micro organism quantity between plant inside and exterior within the presence of soil micro organism collectively confirmed that soil micro organism, particularly Proteobacteria, may seize RP4 from E. coli after which translocate into plant microbiome, ensuing within the elevated RP4 plasmid unfold within the plant endophytes. Total, our findings offered vital insights into the dissemination of ARB and ARGs from the atmosphere to the plant microbiome.

xcellentis
xcellentis

Sulfuric Acid Solution (1N)

SAQ125 125 ml
EUR 60

Sulfuric Acid Solution (1N)

SAQ500 500 ml
EUR 66

Sulfuric Acid Solution (1N)

SAQ999 1000 ml
EUR 74

pET- NLS- Cas9- 6xHis

PVT10639 2 ug
EUR 301

pET-dCas9-VP64-6xHis

PVT17702 2 ug
EUR 300

pET-6xHis-(-30)GFP

PVT17881 2 ug
EUR 341

Cytochrome P450 14a-demethylase inhibitor 1n

E1KS2148 2mg
EUR 521

Mouse Anti-6xHIS Tag monoclonal antibody

CABT-BL8767 100ug
EUR 559

Recombinant Thermobifida Fusca Cutinase(C-6xHis)

CR10-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 10mM Tris-HCl,1mM 2-mercaptoethanol,2mM MnCl2,150mM NaCl,pH7.5.

Recombinant Thermobifida Fusca Cutinase(C-6xHis)

CR10-1mg 1mg
EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 10mM Tris-HCl,1mM 2-mercaptoethanol,2mM MnCl2,150mM NaCl,pH7.5.

Recombinant Thermobifida Fusca Cutinase(C-6xHis)

CR10-500ug 500ug
EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 10mM Tris-HCl,1mM 2-mercaptoethanol,2mM MnCl2,150mM NaCl,pH7.5.

Recombinant Thermobifida Fusca Cutinase(C-6xHis)

CR10-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 10mM Tris-HCl,1mM 2-mercaptoethanol,2mM MnCl2,150mM NaCl,pH7.5.

7077 1 PIPET 1ML STERILE STERILE

7077-1N 200/pk
EUR 238
Description: Disposable Pipets; Disposable Pipets, CGW, Serological, Std Line

7078 1 PIPET 1 X 1/10ML STERI STERILE

7078-1N 250/pk
EUR 241
Description: Disposable Pipets; Disposable Pipets, CGW, Serological, Std Line

7079 1 PIPET 1ML NON STERILE NON STERILE

7079-1N 250/pk
EUR 235
Description: Disposable Pipets; Disposable Pipets, CGW, Serological, Std Line

Human Probable protein phosphatase 1N, PPM1N ELISA KIT

ELI-19718h 96 Tests
EUR 824

Mouse Probable protein phosphatase 1N, Ppm1n ELISA KIT

ELI-36195m 96 Tests
EUR 865

Monoclonal Anti-Poly-His (6xhis) (His-tag) IgG

HISP14-M 100 ug
EUR 482

Phospholipid transfer Antibody

20-abx110096
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal Anti-Poly-His (6xhis) (His-tag) antibody, ascites

HISP11-M 100 ul
EUR 482

Goat Anti-Poly-His (6xhis) (His-tag) IgG, aff pure

HISP16-A 100 ug
EUR 408

Goat Anti-Poly-His (6xhis) (His-tag) IgG-FITC conjugate

HISP16-FITC 100 ul
EUR 347

Rabbit Anti-Poly-His (6xhis) (His-tag) IgG-IR700DX conjugate

HISP17-IR7 100 ul
EUR 408

Human cholest erolester transfer protein/lipid transfer protein ELISA kit

E01C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cholest erolester transfer protein/lipid transfer protein ELISA kit

E01C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cholest erolester transfer protein/lipid transfer protein ELISA kit

E01C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cholest erolester transfer protein/lipid transfer protein ELISA kit

E06C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cholest erolester transfer protein/lipid transfer protein ELISA kit

E06C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cholest erolester transfer protein/lipid transfer protein ELISA kit

E06C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cholest erolester transfer protein/lipid transfer protein ELISA kit

E03C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cholest erolester transfer protein/lipid transfer protein ELISA kit

E03C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cholest erolester transfer protein/lipid transfer protein ELISA kit

E03C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cholest erolester transfer protein/lipid transfer protein ELISA kit

E04C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cholest erolester transfer protein/lipid transfer protein ELISA kit

E04C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cholest erolester transfer protein/lipid transfer protein ELISA kit

E04C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cholest erolester transfer protein/lipid transfer protein ELISA kit

E02C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cholest erolester transfer protein/lipid transfer protein ELISA kit

E02C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cholest erolester transfer protein/lipid transfer protein ELISA kit

E02C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cholest erolester transfer protein/lipid transfer protein ELISA kit

E09C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cholest erolester transfer protein/lipid transfer protein ELISA kit

E09C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cholest erolester transfer protein/lipid transfer protein ELISA kit

E09C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cholest erolester transfer protein/lipid transfer protein ELISA kit

E08C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cholest erolester transfer protein/lipid transfer protein ELISA kit

E08C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cholest erolester transfer protein/lipid transfer protein ELISA kit

E08C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cholest erolester transfer protein/lipid transfer protein ELISA kit

E07C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cholest erolester transfer protein/lipid transfer protein ELISA kit

E07C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cholest erolester transfer protein/lipid transfer protein ELISA kit

E07C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phospholipid transfer Polyclonal Antibody

42297-100ul 100ul
EUR 333

Phospholipid transfer Antibody (Biotin)

20-abx105774
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipid transfer Antibody (FITC)

20-abx107192
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipid transfer Antibody (HRP)

20-abx108612
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea pig cholest erolester transfer protein/lipid transfer protein ELISA kit

E05C0732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cholest erolester transfer protein/lipid transfer protein ELISA kit

E05C0732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cholest erolester transfer protein/lipid transfer protein ELISA kit

E05C0732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig cholest erolester transfer protein/lipid transfer protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cholest erolester transfer protein/lipid transfer protein,CETP/LTP ELISA Kit

201-12-1516 96 tests
EUR 440
  • This cholest erolester transfer protein/lipid transfer protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human cholest erolester transfer protein/lipid transfer protein(CETP/LTP)ELISA Kit

GA-E1532HM-48T 48T
EUR 289

Human cholest erolester transfer protein/lipid transfer protein(CETP/LTP)ELISA Kit

GA-E1532HM-96T 96T
EUR 466

Human cholest erolester transfer protein/lipid transfer protein(CETP/LTP)ELISA Kit

QY-E03917 96T
EUR 361

Bovine Glycolipid transfer protein (GLTP)

1-CSB-EP009539BO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Glycolipid transfer protein(GLTP) expressed in E.coli

Human Phospholipid transfer protein (PLTP)

1-CSB-EP018212HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 80.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in E.coli

Bovine Glycolipid transfer protein (GLTP)

1-CSB-YP009539BO
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Glycolipid transfer protein(GLTP) expressed in Yeast

Human Phospholipid transfer protein (PLTP)

1-CSB-YP018212HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in Yeast

Phosphatidylcholine Transfer Protein (PCTP) Antibody

20-abx003727
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx004303
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx178016
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx178017
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx212015
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycolipid Transfer Protein (GLTP) Antibody

20-abx112809
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylcholine Transfer Protein (PCTP) Antibody

20-abx114433
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein, alpha Antibody

20-abx114447
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein, beta Antibody

20-abx114448
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycolipid Transfer Protein (GLTP) Antibody

20-abx128414
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx131266
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx131267
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospholipid Transfer Protein (PLTP) Antibody

abx146426-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx142148
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx174059
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospholipid Transfer Protein (PLTP) Antibody

20-abx174060
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phosphatidylcholine Transfer Protein (PCTP) Antibody

abx028941-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylcholine Transfer Protein (PCTP) Antibody

abx028941-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

abx033529-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

abx033529-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein, beta Protein

20-abx260804
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein, alpha Protein

20-abx260827
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Transfer factor ELISA Kit

ELA-E1333h 96 Tests
EUR 824

Phospholipid transfer Polyclonal Conjugated Antibody

C42297 100ul
EUR 397

Glycolipid Transfer Protein (GLTP) Antibody

abx233495-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylcholine Transfer Protein (PCTP) Antibody

abx236230-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Glycolipid Transfer Protein (GLTP) Antibody

20-abx303992
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylcholine Transfer Protein (PCTP) Antibody

20-abx302561
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycolipid Transfer Protein (GLTP) Protein

20-abx262570
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Xpert Native Transfer Buffer(10X)

P9001-050 500ml
EUR 93

Xpert Native Transfer Buffer(10X)

P9001-100 1L
EUR 138

Recombinant Glycolipid Transfer Protein (GLTP)

4-RPC502Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NZD2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Glycolipid Transfer Protein expressed in: E.coli

Recombinant Phospholipid Transfer Protein (PLTP)

4-RPC728Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55065
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 10.1
Description: Recombinant Mouse Phospholipid Transfer Protein expressed in: E.coli

Recombinant Phospholipid Transfer Protein (PLTP)

4-RPC728Ra01
  • EUR 469.15
  • EUR 229.00
  • EUR 1484.32
  • EUR 561.44
  • EUR 1022.88
  • EUR 377.00
  • EUR 3560.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: E9PSP1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Phospholipid Transfer Protein expressed in: E.coli

SuperBlot Western Transfer buffer 10X

DG-WEST 500ml
EUR 113.8
  • Product category: Biochemicals/Biological Buffers/Protein Related

Recombinant LanRFP. Expressed from E.coli; with a 6xHis tag at the N-terminus

ABP-FP-RPNCSPR 100 ug Ask for price
    • Product line: Proteins
    • Brand:

Recombinant mTFP1. Expressed from E.coli; with a 6xHis tag at the N-terminus

ABP-FP-TPNCSPR 100 ug Ask for price
    • Product line: Proteins
    • Brand:

Recombinant mWasabi. Expressed from E.coli; with a 6xHis tag at the N-terminus

ABP-FP-WPNCSPR 100 ug Ask for price
    • Product line: Proteins
    • Brand:

Recombinant LanYFP. Expressed from E.coli; with a 6xHis tag at the N-terminus

ABP-FP-YPNCSPR 100 ug Ask for price
    • Product line: Proteins
    • Brand:

Human Transfer factor,TF ELISA Kit

201-12-1733 96 tests
EUR 440
  • This Transfer factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Recombinant Human Phosphatidylinositol Transfer Protein, Beta

7-05896 5µg Ask for price

Recombinant Human Phosphatidylinositol Transfer Protein, Beta

7-05897 25µg Ask for price

Recombinant Human Phosphatidylinositol Transfer Protein, Beta

7-05898 1mg Ask for price

Recombinant Human Phosphatidylinositol Transfer Protein, Alpha

7-05899 5µg Ask for price

Recombinant Human Phosphatidylinositol Transfer Protein, Alpha

7-05900 25µg Ask for price

Recombinant Human Phosphatidylinositol Transfer Protein, Alpha

7-05901 1mg Ask for price

Human Alpha-tocopherol transfer protein (TTPA)

1-CSB-EP025268HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Alpha-tocopherol transfer protein(TTPA) expressed in E.coli

Rat Glycolipid Transfer Protein ELISA kit

E02G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glycolipid Transfer Protein ELISA kit

E02G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glycolipid Transfer Protein ELISA kit

E02G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipid Transfer Protein ELISA kit

E02P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipid Transfer Protein ELISA kit

E02P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipid Transfer Protein ELISA kit

E02P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glycolipid Transfer Protein ELISA kit

E03G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glycolipid Transfer Protein ELISA kit

E03G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glycolipid Transfer Protein ELISA kit

E03G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipid Transfer Protein ELISA kit

E04P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipid Transfer Protein ELISA kit

E04P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipid Transfer Protein ELISA kit

E04P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glycolipid Transfer Protein ELISA kit

E04G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glycolipid Transfer Protein ELISA kit

E04G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glycolipid Transfer Protein ELISA kit

E04G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycolipid Transfer Protein ELISA kit

E01G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycolipid Transfer Protein ELISA kit

E01G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycolipid Transfer Protein ELISA kit

E01G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipid Transfer Protein ELISA kit

E03P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipid Transfer Protein ELISA kit

E03P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipid Transfer Protein ELISA kit

E03P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glycolipid Transfer Protein ELISA kit

E06G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glycolipid Transfer Protein ELISA kit

E06G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glycolipid Transfer Protein ELISA kit

E06G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipid Transfer Protein ELISA kit

E01P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipid Transfer Protein ELISA kit

E01P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipid Transfer Protein ELISA kit

E01P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phosphatidylinositol Transfer Protein Beta (PITPNB) Antibody

abx027127-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein Beta (PITPNB) Antibody

abx027127-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein Beta (PITPNB) Antibody

20-abx014712
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein Alpha (PITPNA) Antibody

20-abx217783
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Tocopherol Transfer Protein (TTPa) Antibody

20-abx175351
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Microsomal Triglyceride Transfer Protein (MTTP) Antibody

20-abx177561
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cholesteryl Ester Transfer Protein (CETP) Antibody

20-abx103571
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cholesteryl Ester Transfer Protein (CETP) Antibody

20-abx103572
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cholesteryl Ester Transfer Protein (CETP) Antibody

20-abx103573
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Cholesteryl Ester Transfer Protein (CETP) Antibody

20-abx103574
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Non-specific lipid-transfer protein Antibody

20-abx110051
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cholesteryl Ester Transfer Protein (CETP) Antibody

20-abx111604
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholesteryl Ester Transfer Protein (CETP) Antibody

abx117085-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Microsomal Triglyceride Transfer Protein (MTTP) Antibody

abx117151-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Alpha Tocopherol Transfer Protein (TTPA) Antibody

20-abx123604
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein Alpha (PITPNA) Antibody

20-abx124376
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Alpha Tocopherol Transfer Protein (TTPA) Antibody

20-abx127070
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein Beta (PITPNB) Antibody

abx036544-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Microsomal Triglyceride Transfer Protein (MTTP) Antibody

20-abx129352
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Tocopherol Transfer Protein (TTPa) Antibody

20-abx129893
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phosphatidylinositol Transfer Protein Beta (PITPNb) Antibody

20-abx131467
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha Tocopherol Transfer Protein (TTPA) Antibody

abx145803-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Human Glycolipid Transfer Protein (GLTP) Protein

20-abx166016
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cholesteryl Ester Transfer Protein (CETP) Antibody

20-abx171720
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha Tocopherol Transfer Protein (TTPA) Antibody

abx031340-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha Tocopherol Transfer Protein (TTPA) Antibody

abx031340-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Microsomal Triglyceride Transfer Protein (MTTP) Antibody

abx034212-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Microsomal Triglyceride Transfer Protein (MTTP) Antibody

abx034212-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein Alpha (PITPNA) Antibody

abx034799-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Transfer Protein Alpha (PITPNA) Antibody

abx034799-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dog Phospholipid Transfer Protein ELISA kit

E08P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipid Transfer Protein ELISA kit

E08P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipid Transfer Protein ELISA kit

E08P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glycolipid Transfer Protein ELISA kit

E09G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glycolipid Transfer Protein ELISA kit

E09G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glycolipid Transfer Protein ELISA kit

E09G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Electron transfer flavoprotein-ubiquinone oxidoreductase

ELA-E0248b 96 Tests
EUR 928

Porcine Electron transfer flavoprotein-ubiquinone oxidoreductase

ELA-E0248p 96 Tests
EUR 928

Rabbit cholesterylester transfer protein ELISA Kit

ELA-E0814Rb 96 Tests
EUR 928

Dog Glycolipid Transfer Protein ELISA kit

E08G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glycolipid Transfer Protein ELISA kit

E08G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glycolipid Transfer Protein ELISA kit

E08G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipid Transfer Protein ELISA kit

E06P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipid Transfer Protein ELISA kit

E06P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipid Transfer Protein ELISA kit

E06P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipid Transfer Protein ELISA kit

E07P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipid Transfer Protein ELISA kit

E07P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipid Transfer Protein ELISA kit

E07P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipid Transfer Protein ELISA kit

E09P0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipid Transfer Protein ELISA kit

E09P0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipid Transfer Protein ELISA kit

E09P0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phospholipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glycolipid Transfer Protein ELISA kit

E07G0192-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glycolipid Transfer Protein ELISA kit

E07G0192-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glycolipid Transfer Protein ELISA kit

E07G0192-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glycolipid Transfer Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transfer factor,TF ELISA Kit

CN-04584H1 96T
EUR 434

Small-scale GMP manufacturing of plasmid DNA utilizing a simplified and totally disposable manufacturing technique

Prior to now years, the demand for small batches of scientific grade plasmid DNA has been rising. For that goal, we designed and certified a scaled-down Good Manufacturing Practices (GMP) manufacturing technique, capable of produce small batches (1-Four mg) of plasmid. The developed technique doesn’t require any advanced manufacturing gear and makes use of solely disposable manufacturing supplies, which makes it simple to implement and simplifies line-clearance. We’ve got efficiently used this technique to provide a number of small batches of two totally different plasmids. The produced plasmids, each formulated in an Electroporation Buffer, are combined and stuffed into small, single-use, aliquots.

High quality management confirmed the robustness of the developed technique and a stability examine confirmed that the ultimate formulation is steady for not less than two years. The ultimate affected person formulation will probably be subsequently utilized in a section I/II scientific trial through which retina cells of sufferers with Age Associated Macular Degeneration, are transfected. The offered manufacturing technique will be generically used for different plasmid constructs and remaining formulation designs.

Perform and distribution of the conjugative plasmid pLM1686 in foodborne Listeria monocytogenes in China

Listeria monocytogenes, a deadly foodborne pathogen has the extraordinary capability to outlive in harsh situations and is a possible menace to public well being. A novel 91 kb plasmid pLM1686 was discovered within the prevalent L. monocytogenes sequence sort (ST) 87 pressure in China. On this examine, the perform and distribution of pLM1686 had been firstly investigated in L. monocytogenes. The outcomes confirmed plasmid pLM1686 had self-transmissible capability and existed in varied sorts of L. monocytogenes isolates belonging to 2 lineages (lineage I and II), 4 serotypes (1/2b, 3b, 1/2c and 1/2a) and 4 STs (ST87, ST59, ST9 and ST120).

The wild pressure LM1686 and transconjugant pressure 10403SP1686 exhibited considerably greater development price and biofilm formation in Modification of Welshimer’s medium (MWB), better salinity tolerance, stronger cell invasion and better cytotoxicity than plasmid-cured pressure and reference pressure 10403S. Furthermore, plasmid curing brought about the lack of cadmium resistance of pressure, and the recipient pressure acquired cadmium resistance after conjugation. Thus, pLM1686 would offer L. monocytogenes benefits of surviving in hostile environments.

Intramuscular Expression of Plasmid-Encoded FVII-Fc Immunoconjugate for Tumor Immunotherapy by Concentrating on Tumoral Blood Vessels and Cells

Tissue issue (TF) has been confirmed to be particularly expressed by vascular endothelial cells (VECs) in strong tumors and sure sorts of malignant tumor cells. Coagulation issue VII (FVII) can particularly bind to TF with excessive affinity, so the FVII-TF interplay supplies an ultimate goal for tumor remedy. Expression of proteins in skeletal muscle mass is a straightforward and economical avenue for steady manufacturing of therapeutic molecules. Nevertheless, it’s tough to deal with strong tumors until now as a result of restricted variety of therapeutic proteins produced by the intramuscular gene expression system. Herein, we strived to discover whether or not anti-tumor results will be achieved through intramuscular supply of a plasmid encoding a FVII-guided immunoconjugate (Icon) molecule by a beforehand established Pluronic L64/electropulse (L/E) approach.

Our examine exhibited a number of fascinating outcomes. 1) The mouse mild chain of FVII (mLFVII) molecule might information crimson fluorescent protein (RFP) to build up predominantly at tumor websites in a TF-dependent method. 2) Intramuscular expression of mLFVII-hFc (human IgG1 Fc) Icon might considerably inhibit the expansion of each liver and lung cancers in nude mice, and the inhibition extent was proportional to the extent of tumor-expressed TF. 3) The variety of blood vessels and the quantity of blood move in tumors had been considerably decreased in mLFVII-hFc Icon-treated mice. 4) This immunotherapy system didn’t show apparent negative effects. Our examine offered an environment friendly and economical system for tumor immunotherapy by focusing on each blood vessels and tumor cells. Additionally it is an open system for synergistic remedy by conveniently integrating different anticancer regimens.

Enterococcal PrgU Supplies Extra Regulation of Pheromone-Inducible Conjugative Plasmids

Environment friendly horizontal gene switch of the conjugative plasmid pCF10 from Enterococcus faecalis relies on the expression of its sort Four secretion system (T4SS) genes, managed by the PQ promoter. Transcription from the PQ promoter is tightly regulated, partially to restrict cell toxicity attributable to overproduction of PrgB, a T4SS adhesin. PrgU performs an vital function in regulating this toxicity by lowering PrgB ranges. PrgU has an RNA-binding fold, prompting us to check whether or not PrgU exerts its regulatory management by way of binding of prgQ transcripts. We used a mix of in vivo strategies to quantify PrgU results on prgQ transcripts at each single-cell and inhabitants ranges. PrgU perform requires a particular RNA sequence inside an intergenic area (IGR) about 400 bp downstream of PQ. PrgU interplay with the IGR reduces ranges of downstream transcripts. Single-cell expression evaluation confirmed that cells expressing prgU decreased transcript ranges extra quickly than isogenic prgU-minus cells. PrgU sure RNA in vitro with out sequence specificity, suggesting that PrgU requires a particular RNA construction or a number of host elements for selective binding in vivo.

PrgU binding to its IGR goal may recruit RNase(s) for focused degradation of downstream transcripts or scale back elongation of nascent transcripts past the IGR. IMPORTANCE Micro organism make the most of sort Four secretion programs (T4SS) to effectively switch DNA between donor and recipient cells, thereby spreading genes encoding antibiotic resistance in addition to varied virulence elements. Regulation of expression of the T4SS proteins and floor adhesins in Gram-positive micro organism is essential, as a few of these are extremely poisonous to the cell. The significance of our analysis lies in figuring out the novel mechanism by which PrgU performs its delicate fine-tuning of the expression ranges. As prgU orthologs are current in varied conjugative plasmids and transposons, our outcomes are doubtless related to understanding of numerous clinically vital switch programs.

pLenti-FOXM1 shRNA-2 Plasmid

PVTBAV08732-2 2 ug
EUR 356

pLenti-JUN shRNA-2 Plasmid

PVTBAV11741-2 2 ug
EUR 356

pLenti-LHX6 shRNA-2 Plasmid

PVTBAV12881-2 2 ug
EUR 356

pLenti-MAGEA3 shRNA-2 Plasmid

PVTBAV13661-2 2 ug
EUR 356

pLenti-RUNX3 shRNA-2 Plasmid

PVTBAV20583-2 2 ug
EUR 356

pLenti-Slc7a11 shRNA-2 Plasmid

PVTBAV21973-2 2 ug
EUR 356

pLenti-STAT3 shRNA-2 Plasmid

PVTBAV22921-2 2 ug
EUR 356

pLenti-XRCC5 shRNA-2 Plasmid

PVTBAV26238-2 2 ug
EUR 356

Recombinant HIV-2 Protease Protein, Untagged, E.coli-10ug

QP12271-10ug 10ug
EUR 201

Recombinant Human BMP-2 Protein, Untagged, E.coli-10ug

QP5363-10ug 10ug
EUR 237

Recombinant Porcine IL 2 Protein, Untagged, E.coli-10ug

QP10699-10ug 10ug
EUR 201

Recombinant Canine MCP 2 Protein, Untagged, E.coli-10ug

QP10782-10ug 10ug
EUR 201

Recombinant Human Arginase-2, GST, E.coli-10ug

QP5676-ec-10ug 10ug
EUR 200

Recombinant Human Glutaredoxin-2, GST, E.coli-10ug

QP8154-ec-10ug 10ug
EUR 200

Recombinant Human CXCL2/ MIP-2 Protein, Untagged, E.coli-10ug

QP1016-10ug 10ug
EUR 237

Recombinant Influenza Parainfluenza Type-2 Protein, Untagged, E.coli-10ug

QP12960-10ug 10ug
EUR 155

Recombinant Mouse MCP-2/ CCL8 Protein, Untagged, E.coli-10ug

QP5471-10ug 10ug
EUR 237

Recombinant Human MMP-2 Protein, His, HEK 293-10ug

QP10790-10ug 10ug
EUR 201

Recombinant Human STC 2 Protein, Untagged, HEK 293-10ug

QP13613-10ug 10ug
EUR 201

Recombinant Bovine FGF 2 Protein, Untagged, Native Protein-10ug

QP10599-10ug 10ug
EUR 355

Recombinant Human Semenogelin-2 Protein, His, Yeast-10ug

QP9386-ye-10ug 10ug
EUR 308

Recombinant Human Hyaluronidase-2 Protein, His, Yeast-10ug

QP9753-ye-10ug 10ug
EUR 236

Recombinant Human Ficolin-2 Protein, His, Yeast-10ug

QP9759-ye-10ug 10ug
EUR 236

Recombinant Zebrafish Metallothionein-2 Protein, His, Yeast-10ug

QP9826-ye-10ug 10ug
EUR 362

Recombinant Mouse Arginase-2, His-SUMO, E.coli-10ug

QP5677-ec-10ug 10ug
EUR 272

Recombinant Mouse Bcl-2 Protein, His, E.coli-10ug

QP5710-ec-10ug 10ug
EUR 155

Recombinant Bovine FGF 2 Protein, Untagged, E.coli-10ug

QP10599-EC-10ug 10ug
EUR 155

Recombinant Human Plastin-2 Protein, His, Yeast-10ug

QP6289-ye-10ug 10ug
EUR 236

Recombinant Human Galectin-2 Protein, GST, E.coli-10ug

QP6295-ec-10ug 10ug
EUR 200

Recombinant Human Metaxin-2 Protein, GST, E.coli-10ug

QP6393-ec-10ug 10ug
EUR 272

Recombinant Human Twinfilin-2 Protein, GST, E.coli-10ug

QP7777-ec-10ug 10ug
EUR 200

Recombinant Human Prohibitin-2 Protein, GST, E.coli-10ug

QP8027-ec-10ug 10ug
EUR 200

Recombinant Human Talin-2 Protein, His, Yeast-10ug

QP8291-ye-10ug 10ug
EUR 236

Recombinant Chicken Vitellogenin-2 Protein, His, E.coli-10ug

QP8859-ec-10ug 10ug
EUR 326

Recombinant Mouse Renin-2 Protein, His, E.coli-10ug

QP8886-ec-10ug 10ug
EUR 272

Recombinant Human Metallothionein-2 Protein, GST, E.coli-10ug

QP8894-ec-10ug 10ug
EUR 200

Recombinant E.coli Thioredoxin-2 Protein, His, Yeast-10ug

QP7012-ye-10ug 10ug
EUR 362

Recombinant Mouse Thrombospondin-2 Protein, His, E.coli-10ug

QP6786-ec-10ug 10ug
EUR 272

Recombinant Mouse Thrombospondin-2 Protein, His, Yeast-10ug

QP6786-ye-10ug 10ug
EUR 272

Recombinant Human IGF-2/ IGF-II Protein, Untagged, E.coli-10ug

QP5264-10ug 10ug
EUR 136

Recombinant Dengue Virus Dengue Envelope-2 Protein, Untagged, Insect-10ug

QP11626-10ug 10ug
EUR 201

Recombinant Human CCL24/ Eotaxin-2/ MPIF-2 Protein, His, E.coli-10ug

QP8522-ec-10ug 10ug
EUR 200

Recombinant Human Bcl 2 (minus BH4 domain) Protein, His, E.coli-10ug

QP11138-10ug 10ug
EUR 201

Recombinant Human 2-5A-dependent ribonuclease Protein, His-SUMO, E.coli-10ug

QP6997-10ug 10ug
EUR 155

pDONR223-CD73 Plasmid

PVTB00480-2 2 ug
EUR 356

Recombinant Bovine Serpin A3-2 Protein, His, Yeast-10ug

QP9699-ye-10ug 10ug
EUR 362

Recombinant Human SerpinB2/ PAI-2 Protein, Untagged, E.coli-10ug

QP10161-ec-10ug 10ug
EUR 290

Recombinant Human TIMP2/ TIMP-2 Protein, Untagged, E.coli-10ug

QP10162-ec-10ug 10ug
EUR 290

Recombinant Human CCL8/ MCP-2 Protein, Untagged, E.coli-10ug

QP10231-ec-10ug 10ug
EUR 290

Recombinant Human IL2/ Interleukin-2 Protein, Untagged, E.coli-10ug

QP10309-ec-10ug 10ug
EUR 154

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-10ug

QP10390-ec-10ug 10ug
EUR 154

Recombinant Human CCL8/ MCP-2 Protein, GST, E.coli-10ug

QP4994-ec-10ug 10ug
EUR 200

Recombinant Human CCL8/ MCP-2 Protein, His, Yeast-10ug

QP4994-ye-10ug 10ug
EUR 236

Recombinant Human BMP-2 Protein, Untagged, HEK 293-10ug

QP5363-HEK-10ug 10ug
EUR 218

Recombinant Human Caspase-2 Protein, His-SUMO, E.coli-10ug

QP5762-ec-10ug 10ug
EUR 200

Recombinant Mouse Desmoglein-2 Protein, His-SUMO, E.coli-10ug

QP5947-ec-10ug 10ug
EUR 326

Recombinant Human Elongation factor 2 Protein, His, E.coli-10ug

QP5962-ec-10ug 10ug
EUR 200

Recombinant Human Estrogen Receptor 2 Protein, His, Yeast-10ug

QP6000-ye-10ug 10ug
EUR 236

Recombinant Mouse Hyaluronan synthase 2 Protein, His, E.coli-10ug

QP6144-ec-10ug 10ug
EUR 272

Recombinant Mouse Hyaluronan synthase 2 Protein, His, Yeast-10ug

QP6144-ye-10ug 10ug
EUR 272

Recombinant Human IL2/ Interleukin-2 Protein, GST, E.coli-10ug

QP6216-ec-10ug 10ug
EUR 200

Recombinant Human IL2/ Interleukin-2 Protein, His, Yeast-10ug

QP6216-ye-10ug 10ug
EUR 236

Recombinant Rabbit IL2/ Interleukin-2 Protein, His, E.coli-10ug

QP6218-ec-10ug 10ug
EUR 326

Recombinant Human Integrin alpha-2 Protein, His, Yeast-10ug

QP6238-ye-10ug 10ug
EUR 236

Recombinant Human Plastin-2 Protein, His-SUMO, E.coli-10ug

QP6289-ec-10ug 10ug
EUR 200

Recombinant Human 2-oxoglutarate dehydrogenase, His-SUMO, E.coli-10ug

QP6447-ec-10ug 10ug
EUR 200

Recombinant Rat Neuroendocrine convertase 2 Protein, His, E.coli-10ug

QP6473-ec-10ug 10ug
EUR 326

Recombinant Rat SerpinB2/ PAI-2 Protein, His, Yeast-10ug

QP6669-ye-10ug 10ug
EUR 272

Recombinant Human Septin-2 Protein, His-SUMO, E.coli-10ug

QP7552-ec-10ug 10ug
EUR 272

Recombinant Human Clavesin-2 Protein, His-SUMO, E.coli-10ug

QP7684-ec-10ug 10ug
EUR 200

Recombinant Mouse 2-oxoglutarate dehydrogenase, His-SUMO, E.coli-10ug

QP7717-ec-10ug 10ug
EUR 272

Recombinant Human Sesquipedalian-2 Protein, His-SUMO, E.coli-10ug

QP7760-ec-10ug 10ug
EUR 200

Recombinant Human Complexin-2/ CPLX2 Protein, GST, E.coli-10ug

QP7773-ec-10ug 10ug
EUR 272

Recombinant Human Vasohibin-2 Protein, His-SUMO, E.coli-10ug

QP7784-ec-10ug 10ug
EUR 272

Recombinant Macaque CXCL10/ Crg-2 Protein, His, E.coli-10ug

QP7849-ec-10ug 10ug
EUR 326

Recombinant Human Thioredoxin-2/ TXN2 Protein, GST, E.coli-10ug

QP8009-ec-10ug 10ug
EUR 200

Recombinant Human Calponin-2 Protein, His-SUMO, E.coli-10ug

QP8036-ec-10ug 10ug
EUR 200

Recombinant Human Thioredoxin reductase 2, His-SUMO, E.coli-10ug

QP8200-ec-10ug 10ug
EUR 200

Recombinant Human Talin-2 Protein, His-SUMO, E.coli-10ug

QP8291-ec-10ug 10ug
EUR 200

Recombinant Human Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug

QP8512-ec-10ug 10ug
EUR 200

Recombinant Human TIMP2/ TIMP-2 Protein, GST, E.coli-10ug

QP8571-ec-10ug 10ug
EUR 200

Recombinant Mouse CXCL2/ MIP-2 Protein, His, E.coli-10ug

QP8651-ec-10ug 10ug
EUR 272

Recombinant Human Glutamate carboxypeptidase 2 Protein, His, E.coli-10ug

QP8726-ec-10ug 10ug
EUR 200

Recombinant E.coli GTP cyclohydrolase-2 Protein, His, E.coli-10ug

QP8879-ec-10ug 10ug
EUR 326

Recombinant Mouse Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug

QP8884-ec-10ug 10ug
EUR 272

Recombinant E.coli Thioredoxin-2 Protein, His-SUMO, E.coli-10ug

QP7012-ec-10ug 10ug
EUR 326

Recombinant Human Retinal dehydrogenase 2 Protein, His, Yeast-10ug

QP8968-ye-10ug 10ug
EUR 308

Recombinant Mouse Elongation factor 2 Protein, His, Yeast-10ug

QP9112-ye-10ug 10ug
EUR 272

Recombinant Human MBL-2/ MBL Protein, His, Yeast-10ug

QP9268-ye-10ug 10ug
EUR 236

Recombinant Human Tryptase beta-2 Protein, His, E.coli-10ug

QP6832-ec-10ug 10ug
EUR 200

Recombinant Mouse Tryptase beta-2 Protein, GST, E.coli-10ug

QP6833-ec-10ug 10ug
EUR 272

KRTAP4-2 cloning plasmid

CSB-CL861178HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 411
  • Sequence: ATGGTCAACTCCTGTTGTGGCTCTGTGTGCTCTGACCAGGGCTGTGGCCTAGAGAACTGCTGCCGTCCCAGCTGCTGCCAGACCACCTGCTGCAGGACCACCTGCTGCCGCCCCAGCTGCTGTGTGTCCAGCTGCTGCAGACCGCAGTGCTGCCAGTCTGTGTGCTGCCAGCCCAC
  • Show more
Description: A cloning plasmid for the KRTAP4-2 gene.

KRTAP3-2 cloning plasmid

CSB-CL871617HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 297
  • Sequence: atggattgctgtgcctctcgcagctgcagtgtccccactgggcctgccaccaccatctgctcctccgacaaatcctgccgctgtggagtctgcctgcccagcacctgcccacacacagtttggttactggagcccatctgctgtgacaactgtcccccaccctgccacattcctca
  • Show more
Description: A cloning plasmid for the KRTAP3-2 gene.

KRTAP9-2 cloning plasmid

CSB-CL880139HU1-10ug 10ug
EUR 257
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 525
  • Sequence: ATGACCCACTGTTGCTCCCCTTGCTGTCAGCCTACATGCTGCAGGACCACCTGCTGCAGGACCACCTGCTGGAAGCCCACCACTGTGACCACCTGCAGCAGCACATCCTGCTGCCAGCCCGCCTGCTGTGTGTCCAGCTGCTGCCAGCCTTGCTGCCGCCCAACTTCCTGTCAAAA
  • Show more
Description: A cloning plasmid for the KRTAP9-2 gene.

KRTAP9-2 cloning plasmid

CSB-CL880139HU2-10ug 10ug
EUR 257
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 525
  • Sequence: atgacccactgttgctccccttgctgtcagcctacctgctgcaggaccacctgctgcaggaccacctgctggaagcccaccactgtgaccacctgcagcagcacaccctgctgccagcccgcctgctgtgtgtccagctgctgccagccttgctgccgcccaacttgctgtcaaaa
  • Show more
Description: A cloning plasmid for the KRTAP9-2 gene.

KRTAP12-2 cloning plasmid

CSB-CL012606HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: ATGTGTCATACCAGCTGCTCCTCGGGCTGCCAGCCAGCCTGCTGCGCGCCCAGCCCCTGCCAGCCAGCCTGTTGTGTGCCCAGCTCCTGCCAGGCATCCTGCTGTGTGCCTGTGGGCTGCCAGTCCTCCGTGTGTGTGCCCGTGAGCTTCAAGCCAGCCGTGTGCCTGCCCGTGAG
  • Show more
Description: A cloning plasmid for the KRTAP12-2 gene.

Plasmid Midi Kit I

K1314-2
EUR 262

Plasmid Midi Kit II

K1315-2
EUR 262

Plasmid ezFilter Mega3 Kit

K1320-2
EUR 343

Plasmid ezFilter Mega6 Kit

K1321-2
EUR 370

Plasmid ezFilter Mega10 Kit

K1322-2
EUR 452

pCR4-TOPO-RNF135 Plasmid

PVTB01189-2 2 ug
EUR 356

pGEM-Ltf(Q25R) Plasmid

PVTB50084-2 2 ug
EUR 356

Recombinant Human FKBP6 Protein, His, -10ug

QP10610-10ug 10ug
EUR 201

Recombinant Human Transmembrane protease serine 2 Protein, His, Yeast-10ug

QP9439-ye-10ug 10ug
EUR 272

Recombinant Mouse Protein delta homolog 2 Protein, His, Yeast-10ug

QP9838-ye-10ug 10ug
EUR 308

Recombinant Human IL12RB2/ IL12R-beta 2 Protein, His, Yeast-10ug

QP9881-ye-10ug 10ug
EUR 236

Recombinant Human Ribonucleoprotein PTB-binding 2 Protein, His, Yeast-10ug

QP9902-ye-10ug 10ug
EUR 236

Recombinant Human Growth/ differentiation factor 2 Protein, His, Yeast-10ug

QP9936-ye-10ug 10ug
EUR 236

Recombinant Human Exportin-2 Protein, His-SUMO, Invitro-E.coli-10ug

QP9974-iv-10ug 10ug
EUR 780

Recombinant Human NAP-2/ PPBP/ CXCL7 Protein, Untagged, E.coli-10ug

QP10212-ec-10ug 10ug
EUR 290

Recombinant Rat NAP-2/ PPBP/ CXCL7 Protein, Untagged, E.coli-10ug

QP10285-ec-10ug 10ug
EUR 290

Recombinant Human AK2/ Adenylate kinase 2 Protein, GST, E.coli-10ug

QP5635-ec-10ug 10ug
EUR 200

Recombinant Human CALCB/ CGPR/ Calcitonin 2 Protein, GST, E.coli-10ug

QP5747-ec-10ug 10ug
EUR 200

Recombinant Human Calpain-2 catalytic subunit Protein, His, E.coli-10ug

QP5756-ec-10ug 10ug
EUR 200

Recombinant Human CETN2/ Centrin 2 Protein, His-SUMO, E.coli-10ug

QP5820-ec-10ug 10ug
EUR 200

Recombinant Human CFL2/ cofilin 2/ ADF Protein, GST, E.coli-10ug

QP5825-ec-10ug 10ug
EUR 200

Recombinant Human Clathrin heavy chain 2 Protein, His, E.coli-10ug

QP5842-ec-10ug 10ug
EUR 200

Recombinant Human Clathrin heavy chain 2 Protein, His, Yeast-10ug

QP5842-ye-10ug 10ug
EUR 236

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug

QP5968-ec-10ug 10ug
EUR 200

Recombinant Human Glycerol kinase 2 Protein, His-SUMO, E.coli-10ug

QP6085-ec-10ug 10ug
EUR 200

Recombinant Macaque IL2/ Interleukin-2 Protein, His-SUMO, E.coli-10ug

QP6217-ec-10ug 10ug
EUR 326

Recombinant Human Integrin alpha-2 Protein, His-SUMO, E.coli-10ug

QP6238-ec-10ug 10ug
EUR 200

Recombinant Human JAM-2/ JAM-B Protein, His, E.coli-10ug

QP6247-ec-10ug 10ug
EUR 200

Recombinant Human JAM-2/ JAM-B Protein, His, Yeast-10ug

QP6247-ye-10ug 10ug
EUR 236

Recombinant Rat MMP-2/ CLG4A Protein Protein, His, Yeast-10ug

QP6369-ye-10ug 10ug
EUR 272

Recombinant Human Nanos homolog 2 Protein, His-SUMO, E.coli-10ug

QP6402-ec-10ug 10ug
EUR 200

Recombinant Human Nuclear transport factor 2 Protein, GST, E.coli-10ug

QP6442-ec-10ug 10ug
EUR 200

Recombinant Human Phosphomannomutase 2/ PMM2/ CDG1 Protein, GST, E.coli-10ug

QP6508-ec-10ug 10ug
EUR 200

Recombinant Human PTGS2/ COX2/ PGHS-2 Protein, His, E.coli-10ug

QP6551-ec-10ug 10ug
EUR 200

Recombinant Rat SerpinB2/ PAI-2 Protein, His-SUMO, E.coli-10ug

QP6669-ec-10ug 10ug
EUR 272

Recombinant Human Serine palmitoyltransferase 2 Protein, His-SUMO, E.coli-10ug

QP6726-ec-10ug 10ug
EUR 200

Recombinant Mouse Hemoglobin subunit beta-2 Protein, GST, E.coli-10ug

QP7346-ec-10ug 10ug
EUR 272

Recombinant Mouse Hemoglobin subunit beta-2 Protein, His, Yeast-10ug

QP7346-ye-10ug 10ug
EUR 272

Recombinant Human Protein delta homolog 2 Protein, GST, E.coli-10ug

QP7755-ec-10ug 10ug
EUR 200

Recombinant Human Protein delta homolog 2 Protein, His, Yeast-10ug

QP7755-ye-10ug 10ug
EUR 236

Recombinant Human CD112/ Nectin-2/ PVRL2 Protein, His, E.coli-10ug

QP7863-ec-10ug 10ug
EUR 200

Recombinant Human GMP reductase 2 Protein, His-SUMO, E.coli-10ug

QP8126-ec-10ug 10ug
EUR 200

Recombinant Human AGO2/ Argonaute 2/ EIF2C2 Protein, His, E.coli-10ug

QP8243-ec-10ug 10ug
EUR 200

Recombinant Human AGO2/ Argonaute 2/ EIF2C2 Protein, His, Yeast-10ug

QP8243-ye-10ug 10ug
EUR 236

Recombinant Human RuvB-like 2 Protein, His-SUMO, E.coli-10ug

QP8295-ec-10ug 10ug
EUR 272

Recombinant Human Glucosidase 2 subunit beta Protein, GST, E.coli-10ug

QP8431-ec-10ug 10ug
EUR 200

Recombinant Human IGF-2/ IGF-II Protein, GST, E.coli-10ug

QP8601-ec-10ug 10ug
EUR 200

Recombinant Human NAP-2/ PPBP/ CXCL7 Protein, GST, E.coli-10ug

QP8641-ec-10ug 10ug
EUR 200

Recombinant Human Laminin subunit beta-2 Protein, His, E.coli-10ug

QP8788-ec-10ug 10ug
EUR 200

Recombinant Rat BDNF Protein Isoform 2 Protein, His, E.coli-10ug

QP8869-ec-10ug 10ug
EUR 272

Recombinant Human Tumor suppressor candidate 2 Protein, GST, E.coli-10ug

QP6856-ec-10ug 10ug
EUR 200